> HOME
> CURRENT
> RANDOM
> BEST OF
> RSS FEED
> CONTACT
    _    ____   ____ ___ ___      _         _     _____          _       
   / \  / ___| / ___|_ _|_ _|    / \   _ __| |_  |  ___|_ _ _ __| |_ ___ 
  / _ \ \___ \| |    | | | |    / _ \ | '__| __| | |_ / _` | '__| __/ __|
 / ___ \ ___) | |___ | | | |   / ___ \| |  | |_  |  _| (_| | |  | |_\__ \
/_/   \_\____/ \____|___|___| /_/   \_\_|   \__| |_|  \__,_|_|   \__|___/
"CAN WE BRING BACK THE FEDERALIST PARTY"
BY NUMBER <
BY TITLE <
BY DATE <
BY DAY <
BY CALENDAR <
BY KEYWORD <

2010 (6)
24 (8)
911 (30)
aaliyah (7)
adventure (3)
al franken (2)
al gore (2)
al qaeda (2)
alice cooper (2)
alien (4)
aliens colonial marines (2)
all you have (3)
allegra (2)
am i right (17)
amazon (2)
anal* (5)
android (2)
anger* (5)
anime (18)
anna nicole smith (3)
annie ascii (6)
answer bear* (3)
apollo (11)
apple (8)
aquatic* (5)
aria giovanni (4)
asia carrera (2)
asperger (19)
atari (4)
aurora jolie (2)
australia (3)
babylon 5 (3)
bailout (4)
battlefield (16)
battlestar galactica (8)
bbc (2)
beatles (2)
bejeweled (2)
berserkers (2)
best of (33)
best part (12)
beyonce (2)
bible (2)
bionic woman (2)
blank (3)
blog (52)
bob marley (2)
bobby brown (4)
bolo santosi (2)
boner* (3)
bravo (8)
brazil (4)
bright (2)
british (2)
britney spears (3)
brokeback mountain (2)
bush (6)
call of duty (7)
calvin (2)
camgirl (9)
canada (12)
carl sagan (2)
cassini (3)
census (2)
chalkboard (2)
chaps* (3)
charlie sheen (2)
cheers (2)
christmas (15)
clam* (3)
cold war (4)
communism (3)
confessions* (13)
conspiracy duck* (11)
contact (2)
cosby show (4)
cosmos (3)
counter-strike (3)
creampie (3)
critic (4)
crucicaption (6)
crysis (6)
daylight savings (2)
dean (32)
defcon (3)
derek smart (4)
desirae (2)
deus ex (3)
diabetes (4)
dickwolves (3)
die hard (4)
dilbert (6)
disney (25)
doctor who (3)
dont hate me (2)
doom (9)
dot (2)
douglas adams (2)
down syndrome (4)
dr. dre (2)
dr. who (2)
duke nukem (3)
dune (4)
eaten* (2)
einstein (2)
election 2004 (7)
election 2008 (33)
election 2010 (2)
election 2012 (9)
ellen degeneres (2)
er (2)
escher (2)
esperanto (2)
eve online (2)
everybody loves raymond (3)
facebook (9)
family guy (3)
far cry (2)
fear (2)
figlet (37)
filk (2)
flea* (5)
flintstones (3)
football (2)
fred friendly (3)
freespace (6)
french (12)
fresh air (2)
friends (3)
funyuns (2)
garfield (5)
geography (7)
german (24)
gianna michaels (4)
gloria steinem (2)
gnutella (2)
god help me (2)
google (5)
grand theft auto (10)
gun free zones (2)
haiku (9)
haiti (4)
half-life (10)
halloween (2)
halo (4)
ham (2)
hamas (2)
hangin with jesus* (5)
harry potter (4)
harvey milk (2)
henry* (5)
hershey* (3)
hillary clinton (2)
hippies (7)
hitler (2)
hulk (3)
hurricane (7)
ice cube (3)
id software (2)
ideograms (4)
immigration (4)
inconsolable (2)
india (2)
infocom (3)
intelligent design (3)
iphone (3)
iran (5)
iraq (17)
isaac newton (3)
islam (28)
israel (3)
james burke (2)
jasmin st. claire (2)
jave (8)
jeopardy (3)
jerkcity (2)
jesus (19)
jewish (2)
jfk (2)
jimmy carter (3)
jody watley (2)
john f. kennedy (3)
john travolta (2)
jon stewart (3)
joseph kony (2)
jupiter (2)
just cause (3)
kari byron (2)
katamari (3)
kelis (2)
kilroy (2)
kindle (4)
kirara (3)
kirstie alley (3)
kiwi (3)
korean (3)
lady diana (2)
lady gaga (2)
latin (2)
law and order (10)
left 4 dead (3)
left eye (4)
linux (6)
logo (16)
lord of the rings (4)
lost (2)
lottery (2)
lucy lee (2)
lyrics (23)
macintosh (6)
marilyn manson (3)
mariska hargitay (2)
mash (5)
mass effect (8)
math (4)
matrix (5)
me neither (4)
mel gibson (3)
meme (5)
memento (2)
meta (2)
michael jackson (9)
michael moore (5)
michelin (2)
midori (2)
milf (4)
minecraft (4)
minotaur* (2)
monads (2)
mormon (2)
msnbc (2)
muppets (4)
myfreecams (6)
mythbusters (2)
nabis (2)
napster (3)
nasa (8)
nazi (12)
nerd boy (9)
net neutrality (2)
nethack (4)
newsgroup (47)
newsradio (2)
niven (2)
nobel prize (4)
north korea (3)
npr (4)
obama (12)
oceans thirteen (2)
oj simpson (2)
okcupid (2)
olympics (3)
onion (3)
open source (10)
original (56)
orkut (2)
osama bin laden (6)
p2p (4)
pac-man (6)
pajamas media (4)
panther (4)
particle (2)
patriot act (2)
peanuts (15)
pearl harbor (3)
penn and teller (2)
penny arcade (2)
perl (2)
perspective (6)
petition (7)
playstation (2)
please shut up* (2)
plonk (5)
pluto (6)
poem (4)
pokemon (6)
poker (13)
polyamory (3)
pooh (8)
porn (46)
pornstar (65)
portal (7)
powerpuff (2)
proposal (2)
python (2)
quake (8)
quebec (2)
queer eye (3)
r. kelly (3)
rage (2)
rape rays* (3)
red bull (3)
red dwarf (2)
rent (2)
richard stallman (2)
rihanna (3)
roger ebert (7)
roman polanski (2)
ron paul (4)
russian (2)
safe word (3)
sanrio (4)
sarah silverman (2)
saturday night live (3)
saving grace (2)
science fact (3)
scrubs (4)
seaquest (2)
second life (2)
seinfeld (2)
sesame (7)
sesame street (3)
shakespeare (3)
shield (3)
shitting* (3)
shutdown (2)
simple (20)
simpsons (8)
skeptic (3)
skull (2)
slashdot (4)
smurfs (3)
soccer (6)
south park (4)
space shuttle (5)
special (2)
spice girls (4)
spongebob (2)
spore (2)
squirtle (2)
star trek (35)
star wars (20)
starcraft (4)
starship troopers (2)
steve jobs (2)
strike (2)
super bowl (3)
sweden (2)
swine flu (3)
tattoo (9)
tax (6)
ted (6)
ted kennedy (3)
tensor (3)
terry gross (2)
tetris (2)
thanksgiving (3)
they might be giants (2)
third rock (2)
tina fey (2)
tlc (3)
togos (2)
tomb raider (4)
tools* (2)
topical (215)
transsexual (2)
transvestite (3)
treo (3)
trilogy* (2)
true story (3)
truther (2)
tsunami (5)
twitter (12)
u2 (3)
understatement (5)
usenet (9)
ussr (4)
uwe boll (2)
vanessa del rio (2)
vectrex (2)
vegan (2)
west wing (12)
wiccan* (10)
wii (2)
wiki (2)
wikileaks (2)
wikipedia (38)
will.i.am (2)
windows (5)
wishful thinking (8)
witchblade (3)
wolfenstein (5)
woody allen (3)
word (113)
world cup (3)
world of warcraft (2)
world war ii (5)
wwjd (3)
wyclef jean (2)
x-men (2)
xbox (2)
xkcd (2)
youtube (8)
zombie* (7)
zynga (2)

#170: COCK

Sat, 1999 Dec 11

original, simple

         c             o            c             k            
8--------------------------------------------------------->    
                                                            tQn

#407: TRILOBITE

Fri, 2000 Aug 4

original, simple

  I'M A TRILOBITE
 /               
0                
  tQn            

#525: LAME

Thu, 2000 Nov 30

figlet, original

                                                   -----               
                                                 /      \              
                                                 )      |              
          :================:                      "    )/              
         /||              ||                      )_ /*                
        / ||    System    ||                          *                
       |  ||     Down     ||                   (=====~*~======)        
        \ || Please wait  ||                  0      \ /       0       
          ==================                //   (====*====)   ||      
   ........... /      \.............       //         *         ||     
   :\        ############            \    ||    (=====*======)  ||     
   : ---------------------------------     V          *          V     
   : |  *   |__________|| ::::::::::  |    o   (======*=======) o      
   \ |      |          ||   .......   |    \\         *         ||     
     --------------------------------- 8   ||   (=====*======)  //     
                                        8   V         *         V      
     --------------------------------- 8   =|=;  (==/ * \==)   =|=     
     \   ###########################  \   / ! \     _ * __    / | \    
      \  +++++++++++++++++++++++++++   \  ! !  !  (__/ \__)  !  !  !   
       \ ++++++++++++++++++++++++++++   \        0 \ \V/ / 0           
        \________________________________\     ()   \o o/   ()         
         *********************************     ()           ()         
                                                                       
                                           EW                          
                                                                       
GET IT ?!?!?! THE GUY IS WAITING FOR THE MACHINE AND HE'S A SKELETON   
BECAUSE HE DIED AND DECAYED HE WAS WAITING SO LONG !!!! STILL DON'T    
GET IT ??? HERE LET ME DRAW A DIAGRAM :::                              
                                                                       
                                         _        _    __  __ _____    
     _____________________________|\    | |      / \  |  \/  | ____|   
    |                               \   | |     / _ \ | |\/| |  _|     
    |_____________________________  /   | |___ / ___ \| |  | | |___    
                                  |/    |_____/_/   \_\_|  |_|_____|   
                                                                    tQn
                                                                       

#649: DNA DOESN'T LIE

Tue, 2001 Apr 3

original

CGTCAGTCAGTCATGCATGCATGCATGC    
CACAGTCAGTCATGCATGCATGCATGCA    
CATGCATGCAGTCAGTCATGCAGTCATG    
CAGTCTGATICHAVEAAIDSTGCATGCA    
ACGTCATGCAGTCATGCATGCATGCAGT    
CACAGTCAGTCATGCATGCATGACGTAC    
CAGTCAGTCAGTCAGTCATGCATGCATG    
                             tQn

#1030: CIRCLE

Fri, 2002 Apr 19

jave, original

                        __.......__                        
                   _.-''           '-..                    
                ,-'                    '-.                 
              ,'                          '.               
            ,'                              '\             
           /                                  `            
          /                                    `.          
         /                                      \          
        |                                        |         
        |                                        |         
        |                                         |        
        |                                         |        
        |                                        .'        
        |                                        |         
         |                                      .'         
          \                                     /          
           \                                  ,'           
            `                                /             
             '.                            ,'              
               '-.                      _,'  tQn           
                  '-._              _,-'                   
                      '`--......---'                       
                                                           
                       I AM A CIRCLE                       
                                                           
  THE SEXIST OF ALL THE MOTHERFUCKING GEOMETRICAL FIGURES  
       THAT'S RIGHT BITCH GAZE UPON ME AND DESPAIR         
                                                           
OH CHRIST I DON'T HAVE ANY APPENDAGES TO TURN LIGHTSWITCHES
            ON AND OFF OR GET MYSELF A SANDWICH            
                                                           
                 HURRRRRRRRRRRRR EXTINCT                   

#1051: FINALLY

Fri, 2002 May 10

original

CHECK OUT MY COOL BUNNY EAR PAJAMAS !!!
 AND MY COOL FUNNY LOOKING HAIR AND MY 
PORTLY STATURE !!!!!! NOT TO MENTION MY
MOUTH WHICH NEVER SHUTS !!!!!!!!!1111!!
  AGGLE DAGGLE GURGLE HUHHHHHHHHHHHHH  
                                       
     |\   CHOP    _,,,---,,_           
     /x`.     .-'`'    -.  ;-;;,_      
    |x4- / _' \ ) )-,_..;\ (  `'-'     
   '---'' .  , (_/--'  `-'\_) tQn      
                                       
             FINALLY                   
        NO MORE HEP KITTEN             

#1270: A POLITICALLY-ORIENTED MESSAGE FROM A FLEA

Sun, 2002 Dec 15

flea*, iraq, original, simple

         I'M IRAQ
                 
       /         
      /          
                 
    .            
tQn              

#1333: SUNDIAL

Sun, 2003 Feb 16

original, word

     _                       
    | |                      
    | |      I'M A HOMOGNOMON
    | |                      
    | |                      
    | |                      
    | |                      
    | |                      
    | |                      
    | |                      
    | |                      
    | |                      
    | |                      
    | |                      
    | | tQn                  
 ___| |___                   
/   |_|   \                  
\_________/                  

#1449: A ROSE FOR THEE

Thu, 2003 Jun 12

original, simple

                        A ROSE FOR THEE                       
                   -------<-------<-------% tQn               
                                                              
OKAY FIRST OFF IT'S COMMON KNOWLEDGE THAT THE HEAD OF THE ROSE
IS BETTER REPRESENTED WITH A @                                
                                                              
FURTHERMORE EVERYONE -- AND I MEAN EVERYONE -- KNOWS THAT THE 
THORNS LOOK FAR BETTER AS { INSTEAD OF <                      
                                                              
P.S. WE HAVE NO LIVES                                         

#1455: A KEY

Wed, 2003 Jun 18

original, simple

    I'M A KEY
             
      /      
     /       
             
0--"         
     tQn     

#1527: A VERY IMPORTANT MESSAGE FROM A FLEA

Fri, 2003 Aug 29

flea*, original, simple

    . --- REJOICE !!! FOR HENCEFORTH YOU SHALL BE PERFECT
tQn                                                      

#1567: A LETTER TO M.C. LYTE

Wed, 2003 Oct 8

aaliyah, jave, original

    |                                                   
 -..|.______                                    `.      
    |       `''''''''''''''''''`----..._          \     
    |         ,-----.                   \          \    
    |        /       \                  |    |     '.   
    '.      /         \               ,'      |     |   
     |     (           )            ,'        |     |   
     |      \         /          ,-'    .     |      |  
     |       \       /        _,'      .'     |      |  
     |        `-----'       ,'        ,'     /       |  
     |                    ,'         /       /       |  
     |                  ,'          /       /        |  
     |                  |         ,'       /         |  
     |                  |        /        /          |  
     |                  \_     ,'        /           |  
     |                    `'-,:.._      /           |   
      |                    ,'     ``-.,:_          .'   
      |                  ,'          ,'  `'''`-----|..._
      |               _,'           /             /     
      |            _.'            ,'             /      
      |        ,,-'              /              ,'      
      | _,.--''                ,'              ,'       
 ....-+'                     ,'               /         
      |                  _.-'               ,'          
  tQn |                 '                  '            
                                                        
DEAR M.C. LYTE                                          
                                                        
ALL THE REST OF US ON EARTH WANT TO SAY                 
HELLO TO YOU IN HEAVEN                                  
                                                        
WE KNOW THAT YOUR TIME HERE WAS SHORT                   
BUT WE HOPE YOU'RE IN A BETTER PLACE NOW                
                                                        
SAY HELLO TO AALIYAH                                    
                                                        
WHAT THE FUCK DO YOU MEAN YOU'RE NOT DEAD               

#1571: BORN AGAIN, BEAT AGAIN

Sun, 2003 Oct 12

aria giovanni, jave, original

                /                         -.                           
               /                           `\   I FOUND JESUS          
             .'                              \                         
            /                     ,._         `   HE BEATS THE CRAP OUT
           /        _____        |/  '.        `   OF ME LIKE ALL      
          |        /'    '-..___.'     `.       `.  THE REST HOWEVER   
          |       /                      \       '.                    
          ||     .'                       |        \                   
          ||     |                        |        |                   
          ||     |  --- .._        _, --- |        ||                  
          |:     |   ,...._       /.....  |        |                   
          | \    |   \._   X     | ____    |       |                   
          |  \   |      '''  |             |       |                   
          |   \  \          /'             |        \                  
         |     \   .       ,|             |          \                 
         |      :  '\     '--..__,       ,'           |                
        ,'      |    \   _              ,'            '\               
       .'       |    |    .'.==--+''   |                '`._           
       /        |     -.   \.....     |                     '`._       
      /         :      `.__     __,.''  ..                      '`     
     |           :     \   ''`-'          '---                         
     /      _,..\|      :                  _/  __                      
    |     .'    \|      |            ,..../      '`.                   
tQn |   .-       |      +-.......---'               L                  

#1596: A MESSAGE FROM SIGMA DRACONIS

Thu, 2003 Nov 6

friends, jave, original

      ,------            \                                 
   ,-'                    `----------                      
  /                                       |    +----------+
 /                ------------.           |    |          |
;                              :          |    |          |
|      ,-----------.           |          |    |          |
|     /             :      |   |          |    |          |
|          ___      |      |   |          |    |          |
:       ,-'   `.    |      |   :          |    |          |
 \     /        \   |      :    :         |    |          |
  :    |         |  |       :   |         |    |          |
  ;    \_       /   :       |             ;    |          |
 /       `._,,,'     `-.    :            ;     |          |
(                       \    \           ;     |          |
 `--------------  tQn    +    `---------'      +----------+
                        /                                  
                       ;                                   
                       |                                   
                      -+-                                  
                                                           
LOOSELY TRANSLATED IT READS:                               
                                                           
    PEOPLE OF EARTH !!!!!                                  
    IF YOU DO NOT SUMMARILY                                
    EXECUTE THE CAST, CREW,                                
    PRODUCERS, AND FANS OF                                 
    THE TELEVISION SHOW FRIENDS                            
    WE WILL HAVE NO CHOICE BUT                             
    TO BOIL YOUR PLANET TO VAPOR                           

#1600: MY BLOG

Mon, 2003 Nov 10

blog, jave, original

               FOLKS CHECK OUT MY BLOG                  
                                                        
 `._                   __......_                        
    -._            /--'                                 
       `-.   ,...               |                       
 |        ,-'    __________   _/                        
 |      ,'  _,--'          === _                        
 |     /   /    `..          '-.`.-----'''-.            
 |     |  /        '-_           '\        |            
 |    |  /            -..         |        |            
|     / |                '-.      |        |            
|    |  |                   '`-._  |       -.           
|    |  |                        '-|_       '......_    
|    |   |                        |  `..                
|    |   \.                      _'     '--.            
 \   |     '-.                 _-           '-..        
  -  |        '`-...._____,..-'                 `\_     
   \_|                                             -.   
     -\                                    _    .    `. 
       `.._                                    ||    ,-|
        `-._---..___                       ||  ||    / |
            ''`--.._'''''''''''''          |'. ||   /  |
                    ''--...___             | | ||  /   |
                              '''----.._  |  ' ||  /   |
                                        '''   V   |   .|
                                              '  ' tQn  

#1754: MIRROR, MIRROR

Mon, 2004 Apr 12

figlet, original

_    _ _  ___          ___.    . ___. .   .    
|\  /| \   |        | /   |    |  __| |___|    
| \/ |     |        | \___|    |    | |   |    
|    |    _|_       .     | ___| ___| |   |    
                                               
   __  ___.  ___.  ___.    _     ___. _____    
  /  |  __| /   | /   |   / \   /   |   |      
 |   |    | \___| \___|  /___\  \___|   |      
  \__| ___|     |     | /     \  /  |   |      
                                               
  ___. .    .   ___   .   .      .   . ___     
 /   | |    |  /   \   \ /       |  /|  |      
 \___| |    | |     |   \        | / |  |      
  /  |  \__/   \___/     \       |/  | _|_     
                                               
  ___.    .   ___   .   . ___. ___.    _       
   __|    |  /   \  |___| .__| .__|   / \      
     |    | |     | |   | |    |     /---\     
  ___|  __|  \___/  |   | |___ |___ /     \    
                                            tQn

#1763: FLEA REMINISCING ON THE SHIELD

Wed, 2004 Apr 21

flea*, original, shield, simple

    YOUR DICK IN MY ASS MEANS YOU'RE GAY         
    MY DICK IN YOUR MOUTH MEANS YOU'RE REALLY GAY
                                                 
      /                                          
                                                 
    .                                            
tQn                                              

#1799: THE ENCHANTED CHALICE

Thu, 2004 May 27

adventure, atari, original

   I'M THE SQUARE FROM ADVENTURE
                                
    /                           
 __                             
|  |                            
|__|                            
    tQn                         

#1944: THE REGISTER

Tue, 2004 Oct 19

original

    ,o.                                             
    888.                                            
    Y88b   YAHOO! STORY! OR! NOT!                   
    ]88b                                            
    ]88b   I! STILL! HATE! IT! WHEN! YOU!           
    ]88b   UNTALENTED! FUCKERS! DO! THIS!           
    ]88b                                            
    ]88b   GET! SOME! REAL! JOURNALISTIC! INTEGRITY!
    `888   YOU! USELESS! TOOLS!                     
     888                                            
     888                                            
     888                                            
    ]88P                                            
    ]88b                                            
    ]888                                            
     `"'                                            
                                                    
      _                                             
    ,888o                                           
    ]888P                                           
tQn  YPP                                            

#1952: FUN FACT

Wed, 2004 Oct 27

original

   O                                             
  o                                              
 .                                               
||         CHECK IT OUT I DREW A BONG            
||.                                              
|/         FUN FACT: I NEVER FINISHED HIGH SCHOOL
||                                               
--                                               
   tQn                                           

#1953: SIDEWAYS CAT POO COILED UP ON A PLATE WITH STEAM RISING

Thu, 2004 Oct 28

original, simple

    [6~
tQn    

#2000: TIC-TAC-TOE IN C#

Tue, 2004 Dec 14

original

   |   |                                                            
 X | O | X                                                          
   |   |                                                            
---+---+---    DUDE CHECK IT OUT !!!!! HERE'S MY TEXT-BASED         
   |   |       SINGLE-PLAYER TIC-TAC-TOE GAME WRITTEN IN C# !!!!!!!!
 O | O | X                                                          
   |   |                                                            
---+---+---                                                         
   |   |       150 MB DOWNLOAD                                      
 X | X | O                                                          
   |   |                                                            
          tQn                                                       

#2100: COMMENTARY ON ROBERT BLAKE BY A FLEA

Thu, 2005 Mar 24

flea*, original, simple

      THE ROBERT BLAKE I CAME TO KNOW AND TRUST 
        FROM MONEY TRAIN WOULD NEVER HURT ANYONE
     /                                          
    .                                           
tQn                                             

#2283: RETRIBUTION

Fri, 2005 Sep 23

jave, original

_,,........._                         
             `-.       ,,---------.   
                |    ,'            \  
               /    /               | 
             ,'     |               | 
            /       |               / 
          ,'         \             /  
         /           '-..______.--'   
         `...-                        
            `-._____                  
                 _-                   
                 |                    
         '       '-\.                 
       ,'          '  '''''---...___  
     ,'               ________,....."'
   ,'                \                
  `"----------       |                
                      L tQn           
                                      
                                      
     I TITLE THIS ONE: RETRIBUTION    

#2303: CONSPIRACY DUCK: COMMENTS

Thu, 2005 Oct 13

conspiracy duck*, logo, original

# I'M A COMMENT                                                   
                                                                  
// I'M A COMMENT TOO                                              
                                                                  
/* WE NEVER LANDED ON THE MOON */                                 
                                                                  
(* THE HOLOCAUST WAS FAKED *)                                     
                                                                  
<!-- ANAL HURTS MORE THAN FACIAL -->                              
                                                                  
REM THE GOVERNMENT IS RUN BY REPTILIAN ALIENS                     
                                                                  
' THE 9/11 ATTACKS WERE A TRICK TO TAKE AWAY OUR LIBERTIES        
                                                                  
; ALIENS CREATED THE PYRAMIDS NOT THE EGYPTIANS                   
                                                                  
~ HITLER'S CLONES ARE ALIVE AND WELL IN COLD STORAGE IN BAVARIA   
                                                                  
                                                                  
o< SEE AS A SOFTWARE ENGINEER I JUST PUT MY CONSPIRACY THEORIES IN
   COMMENTS IN THE CODE I'M WRITING AS WORK FOR HIRE !!! THAT WAY 
   THEY WILL NEVER DIE                                            
                                                                  
   BY THE WAY THE LAST COMMENT IS FOR LOGO !!!!                   
                                                                  
   REPEAT 4 [FORWARD 10 FUCK OFF]                                 

#2391: WHICH DRAGON FROM ADVENTURE

Mon, 2006 Jan 9

adventure, atari, original

          ####                                               
          ####                                               
        ########                                             
        ########   IF YOU COULD BE ANY DRAGON FROM ATARI 2600
########    ####   ADVENTURE WHICH ONE WOULD YOU BE          
########    ####                                             
##############                                               
##############     [ ] YORGLE, THE YELLOW DRAGON WHO IS SLOW 
        ######         AND SCARED OF YELLOW KEYS BECAUSE HE'S
        ######         A PUSSY                               
          ##                                                 
          ##       [ ] GRUNDLE, THE STUPID FAGGOT WITH THE   
          ##           MAGNET FETISH                         
          ##                                                 
      ########     [ ] RHINDLE, THE CRACK FIEND              
      ########                                               
    ############                                             
    ############   WAIT WHAT THE FUCK THESE ARE DUCKS        
  ##############                                             
  ##############                                             
######      ####                                             
######      ####                                             
####        ####                                             
####        ####                                             
####        ####                                             
####        ####                                             
####      ######                                             
####      ######                                             
################                                             
################                                             
    ########                                                 
    ########                                                 
        ##                                                   
        ##                                                   
##      ########                                             
##      ########                                             
######        ##                                             
######        ##                                             
    ############                                             
    ############                                             
tQn                                                          

#2459: BEST DOT COM IDEA EVER

Sat, 2006 Mar 18

figlet, original

 _ __   __ _                      
| '_ \ / _` |     PSTUPIDIDEAQ.COM
| |_) | (_| |                     
| .__/ \__, |                     
|_|       |_| tQn                 

#2637: MASTURBATION HACKS

Tue, 2006 Sep 12

jave, original

M   M  AA   SSS  TTTTTT U   U RRRR  BBBB   AA  TTTTTT III  OOO  N   N 
MM MM A  A S       TT   U   U R   R B   B A  A   TT    I  O   O NN  N 
M M M AAAA  SSS    TT   U   U RRRR  BBBB  AAAA   TT    I  O   O N N N 
M   M A  A     S   TT   U   U R R   B   B A  A   TT    I  O   O N  NN 
M   M A  A SSSS    TT    UUU  R  RR BBBB  A  A   TT   III  OOO  N   N 
                                                                      
                                            H  H  AA   CCC K  K  SSS  
                     .                      H  H A  A C    K K  S     
    ..+7"7:,       JQQW                     HHHH AAAA C    KK    SSS  
.J"`       .:      JHgM                     H  H A  A C    K K      S 
           f    `  Jqm#      `  `           H  H A  A  CCC K  K SSSS  
   `    `.Y        dkm#                                               
     ..Z6+...J?11.,wqq@   `                        TIPS AND TOOLS FOR 
     `?????????+...XHg@zi.                     REALLY RUBBING ONE OUT 
           ...+tOwIHH@Nw0sO.   `                                      
        JZo.JJHwSkNMH@MdddWZy1.                                       
        4Wszz2ddWKBqHHHMmNSzJllt+.                                    
        +=OWsZ&JTNQHMMMHM4JZzOaQWt                                    
         zlzwWsOz+nWWNH0wAQqHHHHH\                              ..ZTTG
         .OOtZdWyOzWWWkHgHHqqkkbX                             .Z^     
           uvrrZXXmgHHHqqqqqqqqkS.                            #       
            ?OzrwfWkkqqqmgggHHUUC`   `                      `.t       
              ?OwWkqmmgHHHU0Zv?!`    J?Ov+`                  .F       
                ?WkHHUUVOv+!``       NH@@H                    U.      
                  ??zz+!!`           NkHHH                    .H.ggaJ.
                     ``             .NkggH                 `.f= T&    
                                    .NkmgR               ` +3    .Ta,.
                                    .HkmHR                .F        `?
                                    .HqmHk                J|          
                                    .HqmHR                .b     `    
                                    JHmmHk?.??z.           T,   .     
                            ....+z17dNmgHHuJ++Fdo.          W,  ......
                      ..+llzlOvi1dJHgHH@HMSe&.JrOZi          S,`` ``..
                      dkllttOj1fKddNHM@@M@MkKdyvwvvZ,     `.?`4,      
                      `HWzlOrzdqMgMdMNMMMMMd#Hdel4vvrX,    .!  N.     
                      .ZWWyOG?+JNdMgXkHHMMMQMN#MJckvwvrn.   i,.,r     
                      .XXWVyO4lJdHMmgHMMMMMNMMH#&I8Xzvzvwi   ?1,N     
                       1OwXWkOv&1J8H@H@HHHMMNM5Ju9rvvvzvvwd,  ?vs     
                       .zzwZXkOwww&JXNHMM8UohA&VwwvwAgQHMMM:  .d6.`   
                        .wrwvXkZwzXXWpbbHWUXXXQmkH@MMHHHHHW ..HSC`    
                       ` .OrrOXfyvuZyffWQkH@gHgHgHHmqqqkkkWMHkV!`     
                          `OrrrXWpWH@@HMHHHHHmmmmmmmmmqqkHW=!`        
                           `zwvvXWHgHHmqqmmmgggggggggggmqW0`          
                            `zwryfkqqqqmmmgggggg@g@@@HHHW0I`          
                             `zwXfkqqqmmggggg@@HHHHUU0VOI?! `         
                              `zwWkqqmggg@HHHWWU0VOvz?!``             
                              ``?WkkHHHHWWU0VZOz?!```                 
                               ` ?XUWUUXZOI+?!``                      
                                ` ?1zzz?!```                          
  ____ . ___  ____ _   _           ````  `   tQn                      
  |  | ' |__] |  |  \_/                                               
  |__|   |__] |__|   |                                TRAN Q. NGUYEN  
                                     WITH A FOREWORD BY PAUL REUBENS  

#2693: FOR HER PLEASURE

Tue, 2006 Nov 7

jave, original

                                ..JJ?....                             
...      .                    ` ...J.. ?4o                            
`vn3.    ` .7!              . ,`  ``!?Wm, Th,                         
 .O4w,                    ,!?.       . ?Wh..h.     FILOVIRIDAE        
  .6SG.         .V?    ..Z'.y.`  `       JN..4,                       
    +Zn          .   `jdY`.Y!              W, j+.                     
    .ZWh,    .J&`    jX' J=`               `4e ?l;                    
      TZXW+.. ?=!..dqM!.dD.            .     ?h.?R                    
       .MmWXWXJ..jdN#!.d=``         ..        ?h ?o                   
    .J7??""dNNKwWMM5..K`            .:.        dr`W,                  
   .r j#YTa..W9MM9zqMMKi...           !        JL W;                  
   d`,Wo+qQW8gMt.JNNZMNZXAv6..       .z:      .dtJ@                   
   ?; WN@?HHH7..MMMMNyMNWWMmAv6...    `     ..M^.@`                   
    ?i..=?I..d8Hj#`dMNkWHw=  `?OxvV9XjJJJJ..gB .#!                    
      ?TN,.MKDJI?N.J@ ?7Y!       `7USAmgQgay9odM;                     
        .h.,B#vTd#`J% `?+.     ...   J&dMY!.dHevTUa..                 
          U+.?WM9!.f`          `...gMY7`..V"`   ?4xlTSn....           
           `T&...v^         ..+VY=! ..VY7`          7T&&+?YX..  .     
                        ..Jk7^ ..dYY!                    ?7uJ+7Tk.... 
                       .f=`.JVY!`                            `?=o+JI7T
                     ..% .@!                                      !??7
                    .J%.J=                                            
                    .K .%                                             
                    J\.d!                                             
                  .`D ,C`                                             
                  .J\.k.                                              
                ` .K`.3.                                              
                  J\ dl`                                              
                 JK .$                                                
                 J!.k..                        FOR HER PLEASURE       
                 V..C                                                 
               `j`2                                                   
               `:.!                                                   
          tQn `:.!                                                    

#2708: SEXCHART

Wed, 2006 Nov 22

original, simple

||| qnq  zngg --|---'        |`---|-|-|-- puevfgl  | | | |  |        | |  |
|||   |    .----|--.         |    |.' |.---'       | | | | wbua      | |  |
||`-. | cravf   | wrjflevpx  |  .-'|  ||.-- sng    | | | `-|--|-- cnrqbfl |
|`. | |  |   .--|--'         `--|--|-.|||          | `-|---|--|----' |  | |
| | | | zbz  |  `.              |  | ||||          |   |   | serql   |  | |
| | | |  |   |   | snttf -------|--' ||||          |   |   |     |   |  | |
| | | fcnprubt --|--'  |        |    ||||          |   |   |     snggyr | |
`-|-|-.  | |`----|--.  pybhq ---|---.||||.-- znznf |   |   |            | |
.-|-|-|--|-|-----|--|------|----|-- cvc!@#! --.    |   | zbzfgvg        | |
| | | |  | |     | gjngfvr |    |     |||||   |    |   | |              | |
|.' | |  | |     `. |      |    `----.||||| hewrjl `-. | |              | |
||  | |  | `------|-|------|-------. |||||`-.        | | |              | |
||  | |  | snttbg | |      |       | |||||  |        | | |              | |
||  | |  |    |   | |      |       | |||||  |        | | |              | |
||  | | penmlgvgf | |    snttbg    | |||||  |        | | |              | |
||  | |   |    `--|-|-------|----. | |||||  |        | | |              | |
||  | | snttyrebp | |       |    | | |||||  |        | | |              | |
||  | |        `--|-|-- shu |   orkl |||||  |        | | |  .-- frgfr   | |
||  | pbpxrggr    | |       |    | | |||||  |        | | |  |           | |
||  `-----|-----. | `-- ubzbfrkl | | ||||| vnzwhfgzr | | |  | grrgrrf   | |
||.-- xnobbz26  | |        |   | | | ||||`-.         | | |  | |         | |
|||   |  |   |  | | qbiref | gvgrf | |||| sntfynlre  | | | gjngf  ktvey | |
                                                                           
  IT'S MY OWN SEX CHART INCLUDING MOM, A GOAT, THAT CHICK WITH THE LIMP,   
  THAT TRAINCAR FULL OF MIDGETS, A RUN DOWN '57 BUICK, AND A FLASHLIGHT    
                                                                           
  OKAY I'M LYING                                                           
                                                                           
                              ,----------.                                 
                              |          |                                 
                              `--- ME ---'                                 
                                           tQn                             

#2825: WP:TOILET

Mon, 2007 Mar 19

original, wikipedia

       .-.                                                   
       | |           WIKIPEDIA IS LIKE A SHIT COVERED PLUNGER
       | |                                                   
 .     |||           YOU HOPE YOU NEVER HAVE TO USE IT AND   
       |||           IT DOESN'T EVEN ALWAYS WORK             
       |||   ,`      BUT SOMETIMES YOU TRY ANYWAY            
       |.|  `,                                               
 `.    |.|   .`   ,` AND YOU SMELL BAD AFTER                 
 ,`    | |  .`   ,                                           
`,     | |       ,`                                          
  '    |_|      ,`                                           
     ,NNNNN,                                                 
    iNNNNNNNi                                                
    ImmmmmmmI                                                
              tQn                                            

#2909: MARGARITAS

Mon, 2007 Jun 11

original

MARGARITAS FOR EVERYONE !!!!!!! 
                                
    | ,  . ; .o |               
    | * o .  .  |               
    | @    ' '  |               
    | ()  ;: '  |               
    | ,  . ; .. | HLUGHBLURHLUB 
    | * o .  .  |               
    | @    ' '  |               
    | ,  . ; .o | GLURHLBUHRLUB 
    | * o .  .  |               
    | @    ' '  |               
    | ()  ;o '  | HLUGHBLURHLUB 
    | ,  . ; :. |               
    | * 8 .  .  |               
    | :    ' '  | HALUBHRLUGHLU 
    | ,  . ;  . |               
    | * o .  .  |               
    | @    ' '  | BLURHALULABHLR
    | ()  ;: :  |               
    | ,  . ; .. |               
    | * o .  .  | HLUGHBLURHLUB 
    | @    ' '  |               
    | ,  . ; .o |               
    | * o .  .  |               
    | @    ' '  |               
    | ()  ;: '  |               
    | ,  . ; .. | HLUGHBLURHLUB 
    | * o .  .  |               
    | @    ' '  |               
    | ,  . ; .o | GLURHLBUHRLUB 
    | * o .  .  |               
    | @    ' '  |               
    | ()  ;o '  | HLUGHBLURHLUB 
    | ,  . ; :. |               
    | * 8 .  .  |               
    | :    ' '  | HALUBHRLUGHLU 
    | ,  . ;  . |               
    | * o .  .  |               
    | @    ' '  | BLURHALULABHLR
    | ()  ;: :  |               
    | ,  . ; .. |               
    | * o .  .  | HLUGHBLURHLUB 
    | @    ' '  |               
    | ,  . ; .o |               
    | * o .  .  |               
    | @    ' '  |               
    | ()  ;: '  |               
    | ,  . ; .. | HLUGHBLURHLUB 
    | * o .  .  |               
    | @    ' '  |               
    | ,  . ; .o | GLURHLBUHRLUB 
    | * o .  .  |               
    | @    ' '  |               
    | ()  ;o '  | HLUGHBLURHLUB 
    | ,  . ; :. |               
    | * 8 .  .  |               
    | :    ' '  | HALUBHRLUGHLU 
    | ,  . ;  . |               
    | * o .  .  |               
    | @    ' '  | BLURHALULABHLR
    | ()  ;: :  |               
    | ,  . ; .. |               
    | * o .  .  | HLUGHBLURHLUB 
    | @    ' '  |               
 tQn                            

#3121: WAKE UP SHEEPLE

Wed, 2008 Jan 9

facebook, figlet, original

o          `O    Oo    `o    O  o.OOoOoo       O       o OooOOo. 
O           o   o  O    o   O    O             o       O O     `O
o           O  O    o   O  O     o             O       o o      O
O           O oOooOoOo  oOo      ooOO          o       o O     .o
o     o     o o      O  o  o     O             o       O oOooOO' 
O     O     O O      o  O   O    o             O       O o       
`o   O o   O' o      O  o    o   O             `o     Oo O       
 `OoO' `OoO'  O.     O  O     O ooOooOoO        `OoooO'O o'      
                                                                 
                                                                 
  .oOOOo.  o      O o.OOoOoo o.OOoOoo OooOOo.   o      o.OOoOoo  
  o     o  O      o  O        O       O     `O O        O        
  O.       o      O  o        o       o      O o        o        
   `OOoo.  OoOooOOo  ooOO     ooOO    O     .o o        ooOO     
        `O o      O  O        O       oOooOO'  O        O        
         o O      o  o        o       o        O        o        
  O.    .O o      o  O        O       O        o     .  O        
   `oooO'  o      O ooOooOoO ooOooOoO o'       OOoOooO ooOooOoO  
tQn                                                              
                   FACEBOOK IS RUN BY THE CIA                    

#3268: SMILEYS

Wed, 2008 Jun 4

original

-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :    
:-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-)     
 :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-)    
) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-    
-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :    
:-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-)     
 :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-)    
) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-    
-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :    
:-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-)     
 :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-)    
) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-    
-) :-) :-) :-                                              :-) :-) :-) :    
:-) :-) :-) : IS IT JUST ME OR DOES A SMILEY MAKE YOU HARD  :-) :-) :-)     
 :-) :-) :-)                                               ) :-) :-) :-)    
) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-    
-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :    
:-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-)     
 :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-)    
) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-    
-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :    
:-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-)     
 :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-)    
) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-    
-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :    
:-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-)     
 :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-)    
) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-) :-    
                                                                         tQn

#3395: NEWTON'S CRADLE

Thu, 2008 Oct 9

isaac newton, original, simple

    o ooooo        NEWTON'S CRADLE
tQn                               

#3403: PBUH

Fri, 2008 Oct 17

islam, original, simple

 IF YOU LOOK CLOSELY YOU'LL NOTICE THAT 
THIS ASCII ART IS A PORTRAIT OF MUHAMMAD
                                        
                    .                   
                      tQn               

#3656: YOUR CHOICE

Sat, 2009 Jun 27

original

   /\                                   
  /  \  I'M EITHER A KLANSMAN OR A PRICK
 / oo \  /                              
/      \                                
|      |                                
|      |                                
|      |                                
        tQn                             

#3669: RUBY ON RAILS

Fri, 2009 Jul 10

original

             0111001101110                          
           10001110101011000                        
         01011100100111010000                       
       10000001101          001                     
      01110011001                                   
     00000011000                                    
    01001000000                                     
   11000110111            RUBY ON RAILS ???         
  010101101110            MORE LIKE SUCKING ON DICKS
  011101000010                                      
 0000001000010                                      
 01000010010000                                     
 100100001001000                                    
 0100100001001000                                   
010010000100100001                                  
0010000100100001tQn                                 

#3759: TENSOR PRODUCT

Thu, 2009 Oct 8

original, simple, tensor

    (X) - I'M A TENSOR PRODUCT !!!!!! EXPAND MY INDICES AND FUCK MY BROWN ASS
tQn                                                                          

#3777: POOR ROOMBA

Mon, 2009 Oct 26

original

 .-'"""`-.    AWWW YEAH FUCKING A ROOMBA                      
(         )                                                   
|`-.___.-'|   WELL MORE ACCURATELY CHASING IT AROUND THE HOUSE
|         |   WITH A BONER AND A MEAT CLEAVER                 
 `-.___.-'                                                    
           tQn                                                

#3990: PARANOIA

Thu, 2010 May 27

original

   o                            
  o O                           
 ......                         
 (    )                         
 |    |                         
 | /\ |                         
(  oO  )                        
 |  > |                         
 |    |                         
 | o  |                         
 |    |                         
 |    | _                       
 |    |//                       
 |    //    YOU'RE JUST PARANOID
 |   //                         
 |    |                         
 |    |                         
 |    |                         
 |    |                         
(......)                        
         tQn                    

#4055: HANGOVER BLUES

Sat, 2010 Jul 31

original, red bull

THIS IS ME AFTER A HORRIBLE HANGOVER         
AND POUNDING DOWN RED BULL TO TRY TO RECOVER:
                                             
| ,  . ; .o |                                
| * o .  .  |                                
| @    ' '  |                                
| ()  ;: '  |                                
| ,  . ; .. | HLUGHBLURHLUB                  
| * o .  .  |                                
| @    ' '  |                                
| ,  . ; .o | GLURHLBUHRLUB                  
| * o .  .  |                                
| @    ' '  |                                
| ()  ;o '  | HLUGHBLURHLUB                  
| ,  . ; :. |                                
| * 8 .  .  |                                
| :    ' '  | HALUBHRLUGHLU                  
| ,  . ;  . |                                
| * o .  .  |                                
| @    ' '  | BLURHALULABHLR                 
| ()  ;: :  |                                
| ,  . ; .. |                                
| * o .  .  | HLUGHBLURHLUB                  
| @    ' '  |                                
| ,  . ; .o |                                
| * o .  .  |                                
| @    ' '  |                                
| ()  ;: '  |                                
| ,  . ; .. | HLUGHBLURHLUB                  
| * o .  .  |                                
| @    ' '  |                                
| ,  . ; .o | GLURHLBUHRLUB                  
| * o .  .  |                                
| @    ' '  |                                
| ()  ;o '  | HLUGHBLURHLUB                  
| ,  . ; :. |                                
| * 8 .  .  |                                
| :    ' '  | HALUBHRLUGHLU                  
| ,  . ;  . |                                
| * o .  .  |                                
| @    ' '  | BLURHALULABHLR                 
| ()  ;: :  |                                
| ,  . ; .. |                                
| * o .  .  | HLUGHBLURHLUB                  
| @    ' '  |                                
| ,  . ; .o |                                
| * o .  .  |                                
| @    ' '  |                                
| ()  ;: '  |                                
| ,  . ; .. | HLUGHBLURHLUB                  
| * o .  .  |                                
| @    ' '  |                                
| ,  . ; .o | GLURHLBUHRLUB                  
| * o .  .  |                                
| @    ' '  |                                
| ()  ;o '  | HLUGHBLURHLUB                  
| ,  . ; :. |                                
| * 8 .  .  |                                
| :    ' '  | HALUBHRLUGHLU                  
| ,  . ;  . |                                
| * o .  .  |                                
| @    ' '  | BLURHALULABHLR                 
| ()  ;: :  |                                
| ,  . ; .. |                                
| * o .  .  | HLUGHBLURHLUB                  
| @    ' '  |                                
         tQn                                 
                                             
WHOA THAT HUGE STREAM OF VOMIT               
TASTED LIKE RED BULL AND FAILURE             

#4060: ANAGRAMS

Thu, 2010 Aug 5

figlet, original

    _    _   _    _    ____ ____      _    __  __           
   / \  | \ | |  / \  / ___|  _ \    / \  |  \/  |          
  / _ \ |  \| | / _ \| |  _| |_) |  / _ \ | |\/| |          
 / ___ \| |\  |/ ___ \ |_| |  _ <  / ___ \| |  | |          
/_/   \_\_| \_/_/   \_\____|_| \_\/_/   \_\_|  |_|          
                                                  tQn       
                                                            
                                                            
   "ALMOST AN ANAGRAM" IS AN ANAGRAM OF "VAGINA MY ALSATIAN"
                                                            
   WHAT                                                     
                                                            
   OH                                                       
                                                            
   IT ISN'T AT ALL IS IT                                    
                                                            
   THIS JUST IN: WORDS MEAN THINGS AND I DON'T KNOW         
   WHAT THE FUCK I'M TALKING ABOUT                          

#4074: A PARTICULAR QUANTUM STATE

Thu, 2010 Aug 19

figlet, original

  __  _  __                                     
 / / | | \ \                                    
/ /  | |  \ \    DRAWING MY DONG'S QUANTUM STATE
\ \  | |  / /    IN BRA-KET NOTATION            
 \_\ |_| /_/                                    
                                                
tQn                                             

#4276: BLACK DOT

Wed, 2011 Mar 9

adventure, atari, original

   I'M THE BLACK DOT FROM ADVENTURE FOR ATARI 2600
                                                  
    /                                             
 __                                               
|  |                                              
|__|                                              
    tQn                                           

#4395: THIS PAGE

Wed, 2011 Jul 6

figlet, original

 _____ _   _ ___ ____    ____   _    ____ _____                           
|_   _| | | |_ _/ ___|  |  _ \ / \  / ___| ____|                          
  | | | |_| || |\___ \  | |_) / _ \| |  _|  _|                            
  | | |  _  || | ___) | |  __/ ___ \ |_| | |___                           
  |_| |_| |_|___|____/  |_| /_/   \_\____|_____|                          
 ___ _   _ _____ _____ _   _ _____ ___ ___  _   _    _    _     _  __   __
|_ _| \ | |_   _| ____| \ | |_   _|_ _/ _ \| \ | |  / \  | |   | | \ \ / /
 | ||  \| | | | |  _| |  \| | | |  | | | | |  \| | / _ \ | |   | |  \ V / 
 | || |\  | | | | |___| |\  | | |  | | |_| | |\  |/ ___ \| |___| |___| |  
|___|_| \_| |_| |_____|_| \_| |_| |___\___/|_| \_/_/   \_\_____|_____|_|  
 _     _____ _____ _____                                                  
| |   | ____|  ___|_   _|                                                 
| |   |  _| | |_    | |                                                   
| |___| |___|  _|   | |                                                   
|_____|_____|_|     |_|                                                   
 ____   ___  ____  ___ _   _  ____                                        
| __ ) / _ \|  _ \|_ _| \ | |/ ___|                                       
|  _ \| | | | |_) || ||  \| | |  _                                        
| |_) | |_| |  _ < | || |\  | |_| |                                       
|____/ \___/|_| \_\___|_| \_|\____|                                       
                                    tQn                                   

#4601: OSHA WARNING

Sat, 2012 Jan 28

original

WARNING: DO NOT BEAT OFF ACROSS THIS LINE                               
                                                                        
--------------------------------------------------------------------    
--------------------------------------------------------------------    
                                                                     tQn

#4811: NP HARD

Sat, 2012 Aug 25

figlet, original

JUGGLING MY BALLS IS NP-HARD 
 ____            _   _ ____  
|  _ \   _____  | \ | |  _ \ 
| |_) | |_____| |  \| | |_) |
|  __/  |_____| | |\  |  __/ 
|_|             |_| \_|_|    
                          tQn

#4826: IDEAS WORTH SUCKING

Sun, 2012 Sep 9

figlet, original, ted

 _____ _____ ____                         
|_   _| ____|  _ \                        
  | | |  _| | | | |    IDEAS WORTH SUCKING
  | | | |___| |_| |                       
  |_| |_____|____/                        
                  tQn                     

#4843: HYPERPALINDROME

Wed, 2012 Sep 26

figlet, original, word

 A HYPERPALINDROME IS A WORD THAT LOOKS 
THE SAME WHEN ROTATED AROUND 180 DEGREES
                                        
      LIKE "1961" OR "COCKBALLS"        
                                        
           _  ___   __   _              
          / |/ _ \ / /_ / |             
          | | (_) | '_ \| |             
          | |\__, | (_) | |             
          |_|  /_/ \___/|_|             
                            tQn         

#4891: TALKING TO YOU ON THE PHONE

Tue, 2012 Nov 13

original

    (  HELLO I AM TALKING TO YOU ON THE PHONE
    |                                        
    |                                        
    |                                        
    |                                        
    |                                        
    |                                        
    ( I HEAR YOU                             
tQn                                          

#5197: A FLEA'S PHILOSOPHICAL CONUNDRUM

Sun, 2013 Sep 15

flea*, original, simple

      I'M WORRIED ABOUT EPISTEMIC CLOSURE
                                         
       /                                 
      /                                  
    .                                    
tQn                                      

#5252: FIVE CCS

Sat, 2013 Nov 9

original, simple

   '''''''''|'''''''''|'''''''''|'''''''''|'''''''''|    FIVE CCS OF GAY
tQn                                                                     

#5254: BASIC MEOW

Mon, 2013 Nov 11

figlet, original

 _  ___          __  __ _____ _____        __    
/ |/ _ \        |  \/  | ____/ _ \ \      / /    
| | | | |       | |\/| |  _|| | | \ \ /\ / /     
| | |_| |       | |  | | |__| |_| |\ V  V /      
|_|\___/        |_|  |_|_____\___/  \_/\_/       
                                                 
 ____   ___       ____  ___ _____ ___    _  ___  
|___ \ / _ \     / ___|/ _ \_   _/ _ \  / |/ _ \ 
  __) | | | |   | |  _| | | || || | | | | | | | |
 / __/| |_| |   | |_| | |_| || || |_| | | | |_| |
|_____|\___/     \____|\___/ |_| \___/  |_|\___/ 

#5280: PALINDROME

Sat, 2013 Dec 7

figlet, original, word

 _        __     _             _  __     _               _     
| | __ _ / _| __| |_ __   __ _| |/ _| __| |___  __ _  __| |    
| |/ _` | |_ / _` | '_ \ / _` | | |_ / _` / __|/ _` |/ _` |    
| | (_| |  _| (_| | | | | (_| | |  _| (_| \__ \ (_| | (_| |    
|_|\__, |_|  \__,_|_| |_|\__, |_|_|  \__,_|___/\__, |\__,_|    
   |___/                 |___/                 |___/        tQn
                                                               
        THIS IS WHAT WORDOLOGISTS CALL A PALINDROME            
                                                               
        BECAUSE IT'S BORING AND NOBODY GIVES A SHIT            

#5285: X-MEN

Thu, 2013 Dec 12

original, simple, x-men

    |     |  [STACK OVERFLOW]
    |_____|                  
    |     |                  
    |     |  XMEN>           
    |_____|                  
    |     |                  
    |     |  XMEN>           
    |_____|                  
    |     |                  
    |     |  XMEN>           
    |_____|                  
    |     |                  
    |     |  XMEN>           
    |_____|                  
    |     |                  
    |     |  XMEN>           
    |_____|                  
    |     |                  
    |     |  XMEN>           
    |_____|                  
    |     |                  
    |     |  XMEN>           
    |_____|                  
    |     |                  
    |     |  XMEN>           
    |_____|                  
    |     |                  
    |     |  XMEN>           
    |_____|                  
    |     |                  
    |     |  XMEN>           
    |_____|                  
    |     |                  
    |     |  XMEN>           
    |_____|                  
tQn                          

FART BACK
IS THIS ALL THERE IS?
CHAT#AAF @ EFnet on IRC
FOLLOW NEW!Conspiracy Duck @ Twitter
TOYS
FACTOIDS
  • number of strips: 5372
  • first strip created on: Fri, 1999 Jun 25 (14.7 years ago)
  • number of upcoming strips: 0 (0.0 weeks' worth; empty on Sat, 2018 Sep 15)
MORE STUFF Jerk Your Own Adventure, oo, Jerkcity, Viscera!, Her!, Those Drinky-Drink Kids, Exploding Dog, Penny Arcade, VG Cats, Dinosaur Comics, Cyanide and Happiness, Nedroid Comics, Wondermark
MORE ASCII ART Andreas Freise's ASCII Art Dictionary, alt.ascii-art FAQ, Open Directory: ASCII Art, Christopher Johnson's ASCII Art Collection, Joan Stark's ASCII Art Gallery, The ASCII Art Universe