> HOME
> CURRENT
> RANDOM
> BEST OF
> RSS FEED
> CONTACT
    _    ____   ____ ___ ___      _         _     _____          _       
   / \  / ___| / ___|_ _|_ _|    / \   _ __| |_  |  ___|_ _ _ __| |_ ___ 
  / _ \ \___ \| |    | | | |    / _ \ | '__| __| | |_ / _` | '__| __/ __|
 / ___ \ ___) | |___ | | | |   / ___ \| |  | |_  |  _| (_| | |  | |_\__ \
/_/   \_\____/ \____|___|___| /_/   \_\_|   \__| |_|  \__,_|_|   \__|___/
"OR SOMETHING LIKE THAT"
BY NUMBER <
BY TITLE <
BY DATE <
BY DAY <
BY CALENDAR <
BY KEYWORD <

Jan 1 (15)
Jan 2 (15)
Jan 3 (15)
Jan 4 (15)
Jan 5 (15)
Jan 6 (15)
Jan 7 (15)
Jan 8 (15)
Jan 9 (15)
Jan 10 (15)
Jan 11 (15)
Jan 12 (15)
Jan 13 (15)
Jan 14 (15)
Jan 15 (15)
Jan 16 (15)
Jan 17 (15)
Jan 18 (15)
Jan 19 (15)
Jan 20 (15)
Jan 21 (15)
Jan 22 (15)
Jan 23 (15)
Jan 24 (15)
Jan 25 (15)
Jan 26 (15)
Jan 27 (15)
Jan 28 (15)
Jan 29 (15)
Jan 30 (15)
Jan 31 (15)
Feb 1 (15)
Feb 2 (15)
Feb 3 (15)
Feb 4 (15)
Feb 5 (15)
Feb 6 (15)
Feb 7 (15)
Feb 8 (15)
Feb 9 (15)
Feb 10 (15)
Feb 11 (15)
Feb 12 (15)
Feb 13 (15)
Feb 14 (15)
Feb 15 (15)
Feb 16 (15)
Feb 17 (15)
Feb 18 (15)
Feb 19 (15)
Feb 20 (15)
Feb 21 (15)
Feb 22 (15)
Feb 23 (15)
Feb 24 (15)
Feb 25 (15)
Feb 26 (15)
Feb 27 (15)
Feb 28 (15)
Feb 29 (4)
Mar 1 (15)
Mar 2 (15)
Mar 3 (15)
Mar 4 (15)
Mar 5 (15)
Mar 6 (15)
Mar 7 (15)
Mar 8 (15)
Mar 9 (15)
Mar 10 (14)
Mar 11 (14)
Mar 12 (14)
Mar 13 (14)
Mar 14 (14)
Mar 15 (14)
Mar 16 (14)
Mar 17 (14)
Mar 18 (14)
Mar 19 (14)
Mar 20 (14)
Mar 21 (14)
Mar 22 (14)
Mar 23 (14)
Mar 24 (14)
Mar 25 (14)
Mar 26 (14)
Mar 27 (14)
Mar 28 (14)
Mar 29 (14)
Mar 30 (14)
Mar 31 (14)
Apr 1 (14)
Apr 2 (14)
Apr 3 (14)
Apr 4 (14)
Apr 5 (14)
Apr 6 (14)
Apr 7 (14)
Apr 8 (14)
Apr 9 (14)
Apr 10 (14)
Apr 11 (14)
Apr 12 (14)
Apr 13 (14)
Apr 14 (14)
Apr 15 (14)
Apr 16 (14)
Apr 17 (14)
Apr 18 (14)
Apr 19 (14)
Apr 20 (14)
Apr 21 (14)
Apr 22 (14)
Apr 23 (14)
Apr 24 (14)
Apr 25 (14)
Apr 26 (14)
Apr 27 (14)
Apr 28 (14)
Apr 29 (14)
Apr 30 (14)
May 1 (14)
May 2 (14)
May 3 (14)
May 4 (14)
May 5 (14)
May 6 (14)
May 7 (14)
May 8 (14)
May 9 (14)
May 10 (14)
May 11 (14)
May 12 (14)
May 13 (14)
May 14 (14)
May 15 (14)
May 16 (14)
May 17 (14)
May 18 (14)
May 19 (14)
May 20 (14)
May 21 (14)
May 22 (14)
May 23 (14)
May 24 (14)
May 25 (14)
May 26 (14)
May 27 (14)
May 28 (14)
May 29 (14)
May 30 (14)
May 31 (14)
Jun 1 (14)
Jun 2 (14)
Jun 3 (14)
Jun 4 (14)
Jun 5 (14)
Jun 6 (14)
Jun 7 (14)
Jun 8 (14)
Jun 9 (14)
Jun 10 (14)
Jun 11 (14)
Jun 12 (14)
Jun 13 (14)
Jun 14 (14)
Jun 15 (14)
Jun 16 (14)
Jun 17 (14)
Jun 18 (14)
Jun 19 (14)
Jun 20 (14)
Jun 21 (14)
Jun 22 (14)
Jun 23 (14)
Jun 24 (14)
Jun 25 (15)
Jun 26 (15)
Jun 27 (15)
Jun 28 (15)
Jun 29 (15)
Jun 30 (15)
Jul 1 (15)
Jul 2 (15)
Jul 3 (15)
Jul 4 (15)
Jul 5 (15)
Jul 6 (15)
Jul 7 (15)
Jul 8 (15)
Jul 9 (15)
Jul 10 (15)
Jul 11 (15)
Jul 12 (15)
Jul 13 (15)
Jul 14 (15)
Jul 15 (15)
Jul 16 (15)
Jul 17 (15)
Jul 18 (15)
Jul 19 (15)
Jul 20 (15)
Jul 21 (15)
Jul 22 (15)
Jul 23 (15)
Jul 24 (15)
Jul 25 (15)
Jul 26 (15)
Jul 27 (15)
Jul 28 (15)
Jul 29 (15)
Jul 30 (15)
Jul 31 (15)
Aug 1 (15)
Aug 2 (15)
Aug 3 (15)
Aug 4 (15)
Aug 5 (15)
Aug 6 (15)
Aug 7 (15)
Aug 8 (15)
Aug 9 (15)
Aug 10 (15)
Aug 11 (15)
Aug 12 (15)
Aug 13 (15)
Aug 14 (15)
Aug 15 (15)
Aug 16 (15)
Aug 17 (15)
Aug 18 (15)
Aug 19 (15)
Aug 20 (15)
Aug 21 (15)
Aug 22 (15)
Aug 23 (15)
Aug 24 (15)
Aug 25 (15)
Aug 26 (15)
Aug 27 (15)
Aug 28 (15)
Aug 29 (15)
Aug 30 (15)
Aug 31 (15)
Sep 1 (15)
Sep 2 (15)
Sep 3 (15)
Sep 4 (15)
Sep 5 (15)
Sep 6 (15)
Sep 7 (15)
Sep 8 (15)
Sep 9 (15)
Sep 10 (15)
Sep 11 (15)
Sep 12 (15)
Sep 13 (15)
Sep 14 (15)
Sep 15 (15)
Sep 16 (15)
Sep 17 (15)
Sep 18 (15)
Sep 19 (15)
Sep 20 (15)
Sep 21 (15)
Sep 22 (15)
Sep 23 (15)
Sep 24 (15)
Sep 25 (15)
Sep 26 (15)
Sep 27 (15)
Sep 28 (15)
Sep 29 (15)
Sep 30 (15)
Oct 1 (15)
Oct 2 (15)
Oct 3 (15)
Oct 4 (15)
Oct 5 (15)
Oct 6 (15)
Oct 7 (15)
Oct 8 (15)
Oct 9 (15)
Oct 10 (15)
Oct 11 (15)
Oct 12 (15)
Oct 13 (15)
Oct 14 (15)
Oct 15 (15)
Oct 16 (15)
Oct 17 (15)
Oct 18 (15)
Oct 19 (15)
Oct 20 (15)
Oct 21 (15)
Oct 22 (15)
Oct 23 (15)
Oct 24 (15)
Oct 25 (15)
Oct 26 (15)
Oct 27 (15)
Oct 28 (15)
Oct 29 (15)
Oct 30 (15)
Oct 31 (15)
Nov 1 (15)
Nov 2 (15)
Nov 3 (15)
Nov 4 (15)
Nov 5 (15)
Nov 6 (15)
Nov 7 (15)
Nov 8 (15)
Nov 9 (15)
Nov 10 (15)
Nov 11 (15)
Nov 12 (15)
Nov 13 (15)
Nov 14 (15)
Nov 15 (15)
Nov 16 (15)
Nov 17 (15)
Nov 18 (15)
Nov 19 (15)
Nov 20 (15)
Nov 21 (15)
Nov 22 (15)
Nov 23 (15)
Nov 24 (15)
Nov 25 (15)
Nov 26 (15)
Nov 27 (15)
Nov 28 (15)
Nov 29 (15)
Nov 30 (15)
Dec 1 (15)
Dec 2 (15)
Dec 3 (15)
Dec 4 (15)
Dec 5 (15)
Dec 6 (15)
Dec 7 (15)
Dec 8 (15)
Dec 9 (15)
Dec 10 (15)
Dec 11 (15)
Dec 12 (15)
Dec 13 (15)
Dec 14 (15)
Dec 15 (15)
Dec 16 (15)
Dec 17 (15)
Dec 18 (15)
Dec 19 (15)
Dec 20 (15)
Dec 21 (15)
Dec 22 (15)
Dec 23 (15)
Dec 24 (15)
Dec 25 (15)
Dec 26 (15)
Dec 27 (15)
Dec 28 (15)
Dec 29 (15)
Dec 30 (15)
Dec 31 (15)

#284: HARD TO TALK

Mon, 2000 Apr 3

 __           __                     
(__\ ------- /__)                    
   \/       \/                       
   / \_____/ \     BHAGHLBHAGUGH     
  <<::. CBR .::>   IT'S HARD TO TALK 
   \:( )_( ):/     WITH A BIG FAT    
 *-|`--   --'|-*   COCK IN YOUR MOUTH
   \  |   |  /                       
    | |/#\| |                        
    : ||#|| :                        
     \||#||/                         
       |#|                           
       \#/                           

#649: DNA DOESN'T LIE

Tue, 2001 Apr 3

original

CGTCAGTCAGTCATGCATGCATGCATGC    
CACAGTCAGTCATGCATGCATGCATGCA    
CATGCATGCAGTCAGTCATGCAGTCATG    
CAGTCTGATICHAVEAAIDSTGCATGCA    
ACGTCATGCAGTCATGCATGCATGCAGT    
CACAGTCAGTCATGCATGCATGACGTAC    
CAGTCAGTCAGTCAGTCATGCATGCATG    
                             tQn

#1014: LOVE

Wed, 2002 Apr 3

ideograms

                                 Moo                          
                               oMMMMM                         
                           ooMMMMMMMMMo                       
                      oooMMMMMMMMMMMMMM                       
                 oooMMMMMMMMMMM""""   ooo                     
            ooMMMMMMMMM""""           "MMMMo                  
         oM""""""   ooo               MMMMMMM                 
         o           MMMMoo          MMMMMMM"                 
         MMMoo       "MMMMMM        MMMMMM                    
          "MMMMM       "MMMMM      MMMM""          o          
           "MMMMM       ""MMM     MMM"o  oooooooMMMMMMo       
             "MMM"         oooooMMMMMMMMMMMMMMM"""MMMMMMMo    
   Mo        oo oooMoMMMMMMMMMM"M""""""  "       oMMMMMMMMMo  
   MMoooMMMMMMMMMM"""""                         oMMMMMM"""""  
  MMMM"""             o              ""MMooo  oMMMM"""        
 oMMMo      o        "MMoMMMMM"        "MMMMMMMM"             
MMMMM      MM  Mo     ""MMMMMM    oo     ""MMMMMMo            
MMMMM     oMM   Moo     ""MMMM     Moo      MMMMMMo           
MMMM    oMMMM    MMMoo     """     "MMoo     "MMMMM           
 """   oMMMM"      "MMMMMoooooo oo oMMMMMo      """           
       oMMMM         ""MMMMMMMMMMMMMMMMMMMMMo                 
       "MMM"      "Moo   """"MMMMMMMMMMMMMMM"                 
        """       oMMMMo                                      
                  MMMMMMo      oooMMooo                       
                 MMMMMMMooMMMMMMMMMMMMMMo                     
               oMMMMMMM"""" "   MMMMMMM""                     
              MMMMMM          oMMMMMM"                        
            oMMMM""MMoo     oMMMMMM""                         
          oMMMM"     "MMMooMMMMMM""                           
       ooMMM""          MMMMMMMM                              
      oMMM"           oMMMMMMMMMMoo                           
    MM""           ooMMMMMM" "MMMMMMooo                       
  o""            oMMMMMM"      "MMMMMMMMMoo                   
             ooMMMMM""           "MMMMMMMMMMMooo              
          ooMMMM""                  MMMMMMMMMMMMMMoooo        
      ooMMM""                         "MMMMMMMMMMMMMMMMMoooo  
       "                               ""MMMMMM:F_P:MMMM""""""
                                                              
    LITERAL TRANSLATION: NO SHIRT NO SHOES NO COCKSUCKING     

#1379: AMERICAN HISTORY X

Thu, 2003 Apr 3

           QUIET                                                         
           THIS IS MY FAVORITE PART OF AMERICAN HISTORY X                
                                                                         
                                            .                            
                        .   \ \ / \ \|   \ | / /  ,                      
                      \  \  | | |  |/ \  | | |/  /  | .                  
                    \  |  \ \ | \ / | | / / / | |   /_/  /               
                \_ \ \ \  |  |\ | | | / | | | / _/,-'/_,-' /             
            _   _ \ \|  \_\_  \| \ \\ | |/ / / / _/ _/,---'  /           
             \___\ \_ \__ \ \ | \ \ | / // | / // _/_/__/ __/_           
           __  _ \_  \   \  |  \ \  |/ |/  | | / / / /___/ _/ _/         
         _   \___  \                                 /  _____/           
          \_ \__ \    -------.___    -----._______     / _/  __/         
            \__ \    _____       -----              __  / __/            
               \               _______   ------'         /               
            __ |     ___________         ___________     | __            
           /  `| ,-' ___________ '.   ,' ___________ `-. |'  \           
           | /` (_,-' _______   `./   \,'   _______ `-._) '\ |           
           | |     ,-'   `._,`-.         ,-'   `._,`-.     | |           
           | |.  ,' `.          `.     ,' `.          `.  :| |           
           | \   `.   `-._____,-,'     `.   `-._____,-,'   / |           
            \  '   `-._______,-'  :   :  `-._______,-'    ' /            
             \_.                  |   |                  ._/             
               |                  |   |                  |               
                \                /     \                /                
                 \              /       \              /                 
                  \            |         |            /                  
                   |           \,--._,--./           |                   
                   |       _,.--'''`-'''`--.._       |                   
--.  ,---.  ,---.  |     ,' __,-----------.__ `.     ,---.  ,---.  ,---. 
-- \(     \(  -- \_|____/_,'\/|  |  |  |  |\/`._\__ / --  )/     )/ --  )
.--.\\  -- \\ .--.\           `-.|__|__|,-'        /,--, // --  //,--, / 
 \__\)\ .--.\\ \__\)                              (/__/ //,--, /(/__/ /  
`---'  \ \__\)`---'                                `---'(/__/ /  `---'   
jrei    `---'                                            `---'           

#1745: JESUS: THE DAWN OF REALIZATION

Sat, 2004 Apr 3

jesus

YOU'VE SEEN THE LAST TEMPTATION OF CHRIST                             
                                                                      
YOU HAVEN'T SEEN THE PASSION OF THE CHRIST YET                        
BUT HAVE A STRONG OPINION ON IT                                       
                                                                      
WELL GET READY !!!!!! HERE COMES ........                             
JESUS: THE DAWN OF REALIZATION                                        
                                                                      
                                                                      
                    I'VE BEEN PUT ON THIS DIRTY SHITBALL OF A PLANET  
                     TO DO WHAT ??!?!?!?!? YOU CAN'T REALLY BE SERIOUS
                                                                      
                       HOW ABOUT FUCK YOU AND I'M OPENING A STARBUCKS 
         . : : : .                                                    
       .:`.  !  ,':.        /                                         
      .. _ ,-'-. _ ..      /                                          
      :   ; _,_ ;   :     /                                           
       ,':_(._.)_:`.  ___/                                            
         /|( - )|\                                                    
        / ////\\\ \                                                   
       / /(\\///)\ \                                                  
       \"""""""""""/                                                  
        \         /                                                   
         `-.   .-'                                                    
    ,\``,`/     \ ,',,/                                               
    ''`\`'---^---`'`\,`hjw                                            

#2110: NAME THAT SONG

Sun, 2005 Apr 3

half-life

   .       .            CARBON STARS WITH ANCIENT SATELLITES COLONIZED 
 +  :      .           BY SENTIENT FUNGI ....                          
           :       _                                                   
       .   !   '  (_)      GAS GIANTS INHABITED BY VAST METEOROLOGICAL 
          ,|.'            INTELLIGENCES .......                        
-  -- ---(-O-`--- --  -                                                
         ,`|'`.              WORLDS STRETCHED THIN ACROSS THE MEMBRANES
       ,   !    .           WHERE THE DIMENSIONS INTERSECT .......     
           :       :  "                                                
           .     --+--     ..... IMPOSSIBLE TO DESCRIBE WITH OUR       
 .:  O!o   .       !        LIMITED VOCABULARY                         

#2475: TOWEL OR WETNAP

Mon, 2006 Apr 3

       ______                                                        
  [===|     |====]                                                   
      |     ||                                                       
      |     ||   COULD SOMEONE GET NADIACL004.JPG A TOWEL (OR WETNAP)
ejm97 |=====||                                                       
      |=====||                                                       
      '"""""'|                                                       
       |     |                                                       
       '"""""'                                                       

#2840: AISHA

Tue, 2007 Apr 3

islam

         ___---___                                                   
      .--         --.                                                
    ./   ()      .-. \.                                              
   /   o    .   (   )  \    AISHA IS ARABIC FOR "MOLESTED AS A CHILD"
  / .            '-'    \                                            
 | ()    .  O         .  |                                           
|                         |                                          
|    o           ()       |                                          
|       .--.          O   |                                          
 | .   |    |            |                                           
  \    `.__.'    o   .  /                                            
   \                   /                                             
    `\  o    ()      /' jgs                                          
      `--___   ___--'                                                
            ---                                                      

#3206: CHIEF INNOVATION OFFICER

Thu, 2008 Apr 3

______________________     Q          
|                    |  ___|\_.-,     
|   I'M THE CHIEF    S\ Q~\___ \|     
|                    |(   )o 5) Q     
|    INNOVATION      |\\  \_ ()       
|                    | \'. _'/'.      
|      OFFICER      .-. '-(  x< \     
|       ,o         /\, '.  )  /'\\    
|______ \'.__.----/ .'\  '.-'/   \\   
     snd '---'q__/.'__ ;    /     \\_ 
              '---'     '--'       `"'

#3571: CLEARLY AND CONCISELY

Fri, 2009 Apr 3

shakespeare

           (((\\\\\                                     
            )_ \\\|                                     
           / \\|\/     WILLIAM SHAKESPEARE SURE COULDN'T
          \\( ), &       WRITE CLEARLY AND CONCISELY    
           \) (  ((                                     
            |` \\ ))) _                                 
            |   \` __|  `                               
            |  , \ ` ,    \                             
            | \  ,\      , \                            
            '  \/  \_ \/    \                           
            `_,`-._   `      \                          
  ejm      /       `-. _ \    `                         
          /   ,`.               \                       
    ===  /   '== =`.            | ====                  
        /    |   === `  /      /=========               
       /     |         /     ,                          
      /______|        /    ,  ========                  
 __-'    | =  ===    /   ,=======                       
'   -  --           (                                   
                     \   \                              
                      \   `                             
                       \    `                           
                        \     `                         
                         \_____ \                       
                          /  `                          
                        _/  /                           
                       '-- '                            

#3936: CHAT ROULETTE

Sat, 2010 Apr 3

     .    _    +     .  ______   .          .     '      .            '+    
  (      /|\      _   _|      \___   .   +    '    .         *              
    /\  ||||| .  | | |   | |      |       .    '                    .    '  
 __||||_|||||____| |_|_____________\________________________________________
 . |||| |||||  /\   _____      _____  .   .       .             .       .   
  . \|`-'|||| ||||    __________            .                               
     \__ |||| ||||      .          .     .     .        -            .   .  
  __    ||||`-'|||  .       .    __________                                 
 .    . |||| ___/  ___________             .  PRO TIP: IF YOU REALLY WANT   
 _   ___|||||__  _           .          _     TO CONFUSE PEOPLE GET ON      
      _ `---'    .   .    .   _   .   .    .  CHAT ROULETTE AND WHEN YOU    
 _  ^      .  -    .    -    .       -    .   SEE A GIRL SHOW A SIGN THAT   
BA                                            READS "SHOW ME YOUR DREAMS"   
                                                                            
                                              THEY WILL NEVER CLICK OFF     
                                              BUT INSTEAD YAP FOREVER       

#4301: ANGALORES

Sun, 2011 Apr 3

india, word

         .--,_                                            
        ['    '\.                                         
         \       `''|     BANGALORE ????? MANGALORE ??????
         |         ,]                                     
          `._      ].     YOU GUYS ARE GOING TO RUN       
            |     \       OUT OF ANGALORES AT THIS RATE   
          _/       -'\                                    
         ,'          ,'                                   
       _/'          \                     ,..-''L_        
  |--''              '-;__        |\     /      .,'       
   \                      `--.__,'_ '----     ,-'         
   `\                             \`-'\__    ,|           
,--;/                             /     .| ,/             
\__                               '|    /  /              
  ./  _-,                         _|   S@yaN              
  \__/ /                        ,/        "               
       |                      _/                          
       |                    ,/                            
       \                   /                              
        |              /.-'                               
         \           _/                   :               
          |         /                      .              
           |        |                     .               
      .    |        |                     '.              
      ;     \       /                     ;\              
      '      |     |                                      
             \    _|                      :               
              \_,/                         "'             
                                          : '             
                                             '            

#4667: THE HUNGER GAMES

Tue, 2012 Apr 3

THE HUNGER GAMES SEEMS PRETTY GAY             
AND THEREFORE AWESOME                         
                                              
BECAUSE I'M A GAY MAN WHO HAS ILLICIT SEX     
WITH OTHER GAY MALES                          
                                              
NO VAGINAS INVOLVED WHATSOEVER                
NOT EVEN AMI EMERSON'S BLOWN OUT OLD PISSFLAPS
                                              
                          ,---.               
                         /    |               
                        /     |               
                       /      |               
                      /       |               
                 ___,'        |               
               <  -'          :               
                `-.__..--'``-,_\_             
                   |o/ <o>` :,.)_`>           
                   :/ `     ||/)              
                   (_.).__,-` |\              
                   /( `.``   `| :             
                   \'`-.)  `  ; ;             
                   | `       /-<              
                   |     `  /   `.            
   ,-_-..____     /|  `    :__..-'\           
  /,'-.__\\  ``-./ :`      ;       \          
  `\ `\  `\\  \ :  (   `  /  ,   `. \         
    \` \   \\   |  | `   :  :     .\ \        
     \ `\_  ))  :  ;     |  |      ): :       
    (`-.-'\ ||  |\ \   ` ;  ;       | |       
     \-_   `;;._   ( `  /  /_       | |       
      `-.-.// ,'`-._\__/_,'         ; |       
         \:: :     /     `     ,   /  |       
          || |    (        ,' /   /   |       
          ||                ,'   / SSt|       

#5032: AMBER WAVES

Wed, 2013 Apr 3

                                               | 
             AMBER WAVES OF PORN              -x-
                                               | 
              v .   ._, |_  .,                   
           `-._\/  .  \ /    |/_                 
               \\  _\, y | \//                   
         _\_.___\\, \\/ -.\||                    
           `7-,--.`._||  / / ,                   
           /'     `-. `./ / |/_.'                
                     |    |//                    
                     |_    /                     
                     |-   |                      
                     |   =|                      
                     |    |                      
--------------------/ ,  . \--------._           
  jg                                             

FART BACK
IS THIS ALL THERE IS?
CHAT#AAF @ EFnet on IRC
FOLLOW NEW!Conspiracy Duck @ Twitter
TOYS
FACTOIDS
  • number of strips: 5372
  • first strip created on: Fri, 1999 Jun 25 (14.7 years ago)
  • number of upcoming strips: 0 (0.0 weeks' worth; empty on Tue, 2020 Jul 14)
MORE STUFF Jerk Your Own Adventure, oo, Jerkcity, Viscera!, Her!, Those Drinky-Drink Kids, Exploding Dog, Penny Arcade, VG Cats, Dinosaur Comics, Cyanide and Happiness, Nedroid Comics, Wondermark
MORE ASCII ART Andreas Freise's ASCII Art Dictionary, alt.ascii-art FAQ, Open Directory: ASCII Art, Christopher Johnson's ASCII Art Collection, Joan Stark's ASCII Art Gallery, The ASCII Art Universe